Part:BBa_K2350014:Design

Design Notes

PCR primers for backbone pPIGBACK (BBa_K2350009) to get Ampicillin resistance gene which has been processed a PstI site-directed mutagenesis
Forward: TGCGCTCTCGCTAGTGGTCAcgcggaacccctatttgttt
Reverse: CACCCGCTGCAAAGCACGATttaccaatgcttaatcagtg

PCR primers for Synechoccocus elongatus PCC7942 genomic DNA to get Lycopene cyclase upstream
Forward: CAATATCCCGTAAAGTTTTT
Reverse: aaacaaataggggttccgcgTGACCACTAGCGAGAGCGCA

PCR primers for Synechoccocus elongatus PCC7942 genomic DNA to get Lycopene cyclase downstream
Forward: cactgattaagcattggtaaATCGTGCTTTGCAGCGGGTG
Reverse: CGGCGTTACCGTCACGTAGT

NOTE:
In order to process a 3 pieces fusion PCR, the PCR primers for Lycopene cyclase upstream and downstream are different from the primers showed in BBa_K2350007 and BBa_K2350008.

Source

Synechoccocus elongatus PCC7942 genomic DNA
Backbone pPIGBACK (BBa_K2350009)

References

1. Cunningham, F. X., Sun, Z., Chamovitz, D., Hirschberg, J., & Gantt, E. (1994). Molecular structure and enzymatic function of lycopene cyclase from the cyanobacterium Synechococcus sp strain PCC7942. The Plant Cell, 6(8), 1107–1121.
2. Chen, P. H., Liu, H. L., Chen, Y. J., Cheng, Y. H., Lin, W. L., Yeh, C. H., & Chang, C. H. (2012). Enhancing CO 2 bio-mitigation by genetic engineering of cyanobacteria. Energy & Environmental Science, 5(8), 8318-8327.
3. Jacobus, A. P., & Gross, J. (2015). Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli. PLoS ONE, 10(3), e0119221.